EST 1804674 is a singleton


Sequence

>1804674 (1 EST) Length=402 TCAGGTTCTTCCGTAAGAAGACTACAACAATATATATATATATATATTATTTACGCTAAACACAGTCCCCGAGACCCAAG GACGGCGCAGAGACGAATGATCGTCGTCAACAAAAGCAGTGAGCCAAGCTGATGAGCCGTGGCGATTGTGGGATGTCCAC GTATGAGATAACGGTCCAAATGCCAAGCCCAACCTGCAGCGCCAGAACGCCGTTGACAGAAATCATGCTACGTCGCAACA TCTTTGGAAGCGCTGCACTGTGGAGAACACAAGCCGCATTCAATCCCAAAATAGATACGGTGCTAACTGCAGCCATCAGG CGGTGCCATGTTTGCGCCGCTGCCGGGTTTTCAAGAGCATTTCGCCACCATGGCTCCACCACAAGAAGGTGGTCGCGGGG AG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804674: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046743340626AI065219TENU2102T. cruzi epimastigote normalized cDNA Library


Date: 22:43:26 on Thu 23 Nov 117.