EST 1804675 is a singleton


Sequence

>1804675 (1 EST) Length=270 TGTCGCCCGAGGCGGAGAGCAGTACTGGGTAGCGGTGAGACAACTGCAAGAAGAGCGACGTGTGGTGCAGGACCGGAAGG AGGCATCGGGGACGCTTCTCTCTGAAGTGAAGGCGCGCCACCAGAGCACCATTGAGGAGGCACTTGCGCAGGAGGAGCAG TTCCGGCAGTACATCCGGCAGCTTGCGGAGGAATCCGTCTTTGTGCGCACACACCAGCGACTTACGGCGGAAGAGATTGA TGCATTCCTCAAAAAGGAGACGGAACAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804675: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046753340627AI065220TENU2103T. cruzi epimastigote normalized cDNA Library


Date: 15:12:58 on Wed 22 Nov 117.