EST 1804679 is a singleton


Sequence

>1804679 (1 EST) Length=340 GGCAACTTTGATGTGGAGGACAAGGACCGTGTGCACTTGCCATCTGTGACTGTGAATGAGCCCACGAAGACGGCGGCGCG AGGGTCACGGCGCCGGCAGAAAATTCCGTGGGAGTCGCTGAGGCTTTTTATTGCCGAGCGGTACGGACCTGAGATGAGCT CCCTCGTCACCGAACATGACGGCAACGCAGAGGACCCTTACTTCACGGTGTTCCTCAAGTCTGTACGTCGCACCGTTCCC GTGCCGCGGCACTGGAACCAGCTGCGTGCCTTCTTGGTGAATCAGGCAGACCGTGAGCGTGCGACGGACCTTGTACCGCC TGAAATTGCCGCGCTCGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804679: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046793340631AI065224TENU2107T. cruzi epimastigote normalized cDNA Library


Date: 0:24:37 on Sat 25 Nov 117.