EST 1804684 is a singleton


Sequence

>1804684 (1 EST) Length=305 TCCCTTCGGGCCACAAGACCTAGTACTGTGGGATGAGTCTTGGACAGAAACAGTGCGTCCAACATCACTCAATAAATAAA TAAATAAATACATTTACATGAGCATGCAGGGAAATGACGAAAAAAGAGAAAAGAAGTTGACGGCCACATTTCCAATTTCT CCATTTCTCCGTCCCGCCCAATCACCTGGCGTCATCACATCTAAAAATGGCAGCGTTCCACATGCCCGTCGCTCGTCCAC ATTTATATTTTTTCTTCACCCACTTTCTTCCTCCATAAATACGTCCCCACCTGAGTTTGTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1804684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046843340636AI065229TENU2113T. cruzi epimastigote normalized cDNA Library


Date: 23:21:12 on Mon 20 Nov 117.