EST 1804694 is a singleton


Sequence

>1804694 (1 EST) Length=370 TGCAGACTTCTGCAAACGAACGACCGGAAAAAAGTCCCGCCTTCTTCCTCTCTCGCCATGAGTCCCAATAAAACATAAAT GAGGGGGAATACCACAACGCGGGTGAAGCGATGGAGCAAAAGTCCTCCCACGCGGCCTTCTCCTGGCTCACTGCTCCATG AGACGTGTCTCAACCGCCCAGCGAGTAGCGCAATTGTTTTGGCGAGAGGGGGCGGCGAGCACTCAGCCCCGGAACCCAAA TCGACGGCGGGATTGCCTTTGGCATCAGAACATGCAGTCTGTGGCTTCTCATCCCCTTGATGATTCGCCAGCAGGCCGAT GTACCTCTGCAACAAAAACTCGGTTCCGCGAAGTTCGCACAATGTGGGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046943340646AI065239TENU2125T. cruzi epimastigote normalized cDNA Library


Date: 11:30:41 on Fri 24 Nov 117.