EST 1804697 is a singleton


Sequence

>1804697 (1 EST) Length=311 GAAAATATATAAATATATGTATTTTTATATATTTAAAAATATAAAAAAATGTTCAGACAGCATTAGACAATAACGAGACA AGCACCATCACTCCTACAGGTGCCGCATTGCTCCCATTCTCCACACACACGTGAGAAACACAGGACGTGGATGCGCAAAC GGCATTTTTAATGCCTGAAATTACCCTTAAAGAAAGAGGATAACAAAANTTTGTGCATTCTTCCCCGCAATGCCTTTATG ACTATAAATGCACTTTATAAAATTACTGCCCGGCAAGTGTCCGAGATGGCCTATCATTGTCCATGCGCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1804697: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18046973340649AI065242TENU2128T. cruzi epimastigote normalized cDNA Library


Date: 12:52:36 on Sat 18 Nov 117.