EST 1804711 is a singleton


Sequence

>1804711 (1 EST) Length=486 CGTCACTTGCTGTAAAGGATGTTGTTTTTGAGCGGCTCAGTGATGAGGCGCTGCACCGCCCTGAGACGGGCGTGCCAACT CCCCTGCAGCACGCTCTTTCCACGGATAATGTGGAGCCGTTGACGCCACTGGCGAACACTGCGGGATGGGGCGGTGAGCA CGGGGGAGGTTGGGCACATGCCGACAGACGTGCCGCGTCTTGTCAAGACAAGTAACACACGTTACAACCGACTCATTTTC CCTCTTCAGATGCCTCCTGCAACCCACAAGTTTAATCGTGCCTTTGTCGACGCAGGGTATCAGCGGCAGTGTCCATCACA CCTGCAGAAATGCTTGTTGTACGCGCCGAGGTGGATCGAATGAGGGAGCGCGTGATGCGAATGGCGCCAAAGTACATGCG TGTGGTGCGTGACCCGCGGTGCCGCGAAGAAGTCCAGGCCGATTTCTGCACTCCAGATGGTGATCTCGTCACCGGTCGTG TGTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047113340663AI065256TENU2143T. cruzi epimastigote normalized cDNA Library


Date: 0:9:23 on Thu 23 Nov 117.