EST 1804719 is a singleton


Sequence

>1804719 (1 EST) Length=414 TAAGGGTGCGCAAAAGGGGCACTCACTGCTAAAGAAGAAGGCCGATGCCCTCGCAATCCGCTACCGCGCGATTATGGGGG ATCTGCGGAATGCCAAAATGGAAATGGTGGAGCAAATCCGGGGAGCGTATTTCACCGTCTCCAAAGCTCAGTTTATAGCG GGCGACATTGGCCTTGCGGTGCAGGAGTCTCTTAAGCTGCCGACATACGCGATGCGACTTCGGGTGGAAAATATTGCCGG TGTGCGTGTGCCAAGTTTTCACGAACGCGAGGAACACAGCGGTGATTTGGTCACGCTGGATGAGAATGGACGGCGAATAG GCACGGCGGGCATCGGCCGCGGTGGCGAACAGCTCCGAGAAGCGTCTGAGAAGTTCCGTGAGACCCTGCGGCTCCTGGTG AAGATTGCGTCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047193340671AI065264TENU2151T. cruzi epimastigote normalized cDNA Library


Date: 17:42:20 on Tue 21 Nov 117.