EST 1804749 is a singleton


Sequence

>1804749 (1 EST) Length=430 GCCGCGTGTTACCGGAGCACACAGTTGTAACACCATGAGGTCTGAGGGCGCGTGTTGCCGTAATACGGGCCATCAAATTT ATTCGAATACTGAAAGAGGAAAAACGAAAAACAACAGCCTTTTATTATGGATTTTTTGATTTATTGATTAGCCATTTTGT TATTGTTCTATTTTTTATTTTTATTTTTGATTGGTGTGTTTTGGTTCTCGGCGACGACGGATTAACGTACTGCCGCATTT GTCCTGAGTGACCGCGTAACGTGTGTATGTGTTTTTGTGTGTTTTTGTGTTTCACGCCCTCTTCGGCAGCCGGTGCTTTC TTTCACAGCTCCAATCAGTGGGGCGAACGCGCTCTGCGATGGTGGCTGGCGTGTGGATCACCGGATTTGATAAAACTCTA GGGACAAAAAATAATCCGTCATGGTGGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1804749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047493340701AI065294TENU2181T. cruzi epimastigote normalized cDNA Library


Date: 15:24:35 on Fri 24 Nov 117.