EST 1804756 is a singleton


Sequence

>1804756 (1 EST) Length=348 TCCATCGGGGATTGTTGTTTGTTTTTTCTTTTTTGTGTGTGTGTATGTGTGAGTGTGGGGCGGAGGTGCAGTCAAATATT CCGTTTGGGACTCCGCCACTATTAATAGGAATAATACCACGGTTGCCGCTTTTTGTGTGCATCCATGTCGCCAACGGTGC TTGTGACTTCGTTGACCGCACTGCTTCTGTATGTGGCATTTGTGTATCCGATCATGACCGACGCGGCGAGGTTCCCGTGG CAGACGCTTCCACCGGGACATCCGGGCAGTGGGAGCCCCGTTATTTATCCGCCAGCACAATTCATTATGTACGGCAGGAG AAGAAGATCACGCCGCGTCCCGTCTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1804756: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047563340708AI065301TENU2188T. cruzi epimastigote normalized cDNA Library


Date: 9:9:1 on Sat 18 Nov 117.