EST 1804759 is a singleton


Sequence

>1804759 (1 EST) Length=420 TCTCTCGCGGCAAGAAGAGACATTGCGAAAACATTAAGTGGTGCAACGTTTGGCGTGGAAGAGCAAGAGCCGTTCGGTGA TCATCCGTACAGTATCGATGCAAATGTAGTTGTGGGTGTAGTCTCAGGTTCCACATTTGCCCCACCGAAGTCCATGATGA ATGGAAAGGTGAATCGGGACCCTGTTTTTAGTGGAGGTAAGGAATTGCCTCGTGATACGCCAACAGCATCGACGTTCTGT TGCCGTGGAGATGCCTCGGAAAAAAAGGGGTTTTCACGTTCAGTAGGAAGCCCTCGATTGTCTGCAAGAAAATCGAACAG CCGCAAAAAACTTTGCGATATTTCTTTGTTCTACACCGGGAATTCAATCGCGACGACGACGACGACGAAGACGGACAAAA GATGGAGAAAAAAAAATGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804759: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047593340711AI065304TENU2191T. cruzi epimastigote normalized cDNA Library


Date: 8:29:51 on Wed 22 Nov 117.