EST 1804770 is a singleton


Sequence

>1804770 (1 EST) Length=352 CGGGAGAGAAAGCGCGATAGAAATTATGCCGTCCGGTAACGGTTGTCGTGCCAATCAGCGTCGGGCGCGGGACAGGCCAA ACAGCAAAAACAAGGCAATGCCCACACGGCGGAGGATCGCAAAAAACACGAGCAATCAAAAACTGTTGTGCAGTGCACAC TGTGCCTGCAGGGATTTCCGCGGACGGTGCGACGCCCAGAGTTGGAGCAGCACTTGGAATCCCGCCACCTCAAGGCGAAT AACACCTTCCAGGAACTCTTTCCTGCCTTTCAGGACGAATGTCAGTCAAGGAGCATGCAACTCAAGCGTCCGTGGCGCCT GTGGCTCACAGAGAAGAAGACATGAGAGAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047703340722AI065315TENU2202T. cruzi epimastigote normalized cDNA Library


Date: 1:16:25 on Tue 21 Nov 117.