EST 1804777 is a singleton


Sequence

>1804777 (1 EST) Length=260 GTGACATGTCGCAGCGATTGATGATTCAATGGCTGCTGCAGGGGATGGTGGAGGCACTTGGGATGCGTGCGGTACAGGAG CGCCTTGAGAAGGACAAGGAGTTACGGTCAAGTACTGTAAAACTGTTCCCTGTGGACGCCAATGAAGAGGGGCTGGAACG GGCGGTTAATTTATTTGAGGCGATGGGACTTGGCGAGTTGGGTGCCGGCGTGCGGGCGCAGTTGGAGAAGGTGCGACGCT CGAGACGAATGACGTTGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804777: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047773340729AI065322TENU2209T. cruzi epimastigote normalized cDNA Library


Date: 17:16:20 on Wed 22 Nov 117.