EST 1804780 is a singleton


Sequence

>1804780 (1 EST) Length=427 GCGGACAGACAGCGTCGTGGAGCCCGGAGTCGAATCCGAAGCGGCGGCGATGCCCTGCCTAAATGGAACGCCGATCAGCG TTGCCAGGGCCGGCGCAGGATCGACGCAATGCGGCCACAGAAGCGAACGCATCGCCTCGCGTATTGGTATAAGAAGCCAT CGAGCGCCATCCCACAGACAGGCATTGCACTGTTTAGAGCGTCAATCTTCACAGGCTCGCCCTTCCTCCTCAACACCCTG CGAACGGGCCCCCTCACGGCATCCGACCCGATACTTCGTTGAATCATGCCCCTCCTGCTCCGACCGCGGCTCCGAGGAGA GCGCATACGGATGCAGTTTGTCTTTGGCCGCTGCGGCGTGTCCCGGAAAGAAGCTTGTGATGCGGCACGCAGAAGGGCAT CCGAACCCGCGCAGTCACAGACACATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804780: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047803340732AI065325TENU2212T. cruzi epimastigote normalized cDNA Library


Date: 2:40:35 on Thu 23 Nov 117.