EST 1804786 is a singleton


Sequence

>1804786 (1 EST) Length=490 TCCGTTGGGTCCGCCATGCAATGTGTGTCCCCAAGAATGATTTCTCCGCCATCCTCCGTGGGTAATTGTGGGCGACAGTC TTCGAGAGGTCAGCAGAAAAACGATGTCTTGTGTCCTGGCCAAACATCACCTTCTCCAACACCGTCAGATGGCTTTACAA CACGATCGATGCAAAAGCAACTTATTCGTAAGCAGTCAATACCCATCCCGCCGGCAAGGCATGGGGAGAAGAGGGGGCCA GAGACACATAGGCACTATTTACTATGCGGCAGCGAAACCTTTAGGCTCAATTCTGGACGCCATCCTTCACAACAAAGTAG CAGAGTCCTCTCTTTGTCGCCCAGTCCGAATGATGTGTTTCATGACACACCAATTCAAAGTGGCCTCTATAGCGGCCGAC GGGGTTACTCAGAAATCAGGATGCTTGACCGTTCTCCTACCCTCTCCTCTGGCCGCAGCAGTCAACGTCCCTTGCCGCAT TCTTGCCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804786: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047863340738AI065331TENU2218T. cruzi epimastigote normalized cDNA Library


Date: 4:12:32 on Wed 22 Nov 117.