EST 1804787 is a singleton


Sequence

>1804787 (1 EST) Length=315 TCAATTCAGCGAAAAACCCCGTGAGCCCCCTTTCCCCTCAGCAATAAATAAAGTCAAAAGATACATATATGTATATTCCG TGTGTGTGCCATCCTCATCCCTCTGGCAGGAAAAAAAGAATATCTACATTTATATCTATTGCGTGCATACAAGTGCAAAG TCACATGCATGTAGCCGCACATAGCACAACAATAAAATTACACCAAGAAGTAACAGAAATAACATCATATGCATTCAACA GACTTTCGACAATTCTATACAGAACATTGGCTCAATTTCCTCATTCATACAAACCTCCTCTTCCCTCTCCCTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804787: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047873340739AI065332TENU2219T. cruzi epimastigote normalized cDNA Library


Date: 13:37:32 on Fri 24 Nov 117.