EST 1804789 is a singleton


Sequence

>1804789 (1 EST) Length=343 TATGCCACGGTATCAGCAGCGGTATAATTATTGGCAGCAGGAACATCAACAACCGGGGCAGCACATGAATCCCCGTTGGA AAGGTCACCATCATTATGACATCCAACAACGTGAATTTCAGTTTGTACAGCGGTGCGACAGGCGAGGCTTCTTTCCGACC TACGAAGCTGCGAGCATTTATCATTTGCCTGCAGGCGGTGTCGGCTCTATGTATCCATGAAATTTTCTTCCCCCCTTTAT ATATATATATATAGTCCTATTGGGCTGCGGTGTGATGAGCTCTATCTGGGCGAACGTGTGGAGGCTCGTGTTCTCCCACC TGACGCGATGTAAATAGGTGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804789: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18047893340741AI065334TENU2221T. cruzi epimastigote normalized cDNA Library


Date: 13:15:12 on Wed 22 Nov 117.