EST 1804809 is a singleton


Sequence

>1804809 (1 EST) Length=573 CGTCTGTGGCGGGACCGGTTCATCCATGCGGCGATGCAATTTAATGATGCGGCTACGACAAAGAAGAGGGATCAAGATGA TGTCACAATGCCTGGAAGTTCTGTTGAGTCTCTGACGCTGGAGGAAATTCCCGTGGAACAGGCGGACGTCTTCGTCTCCT GCTGCGACACNGGGATGATGGAGACCGGCCTGAACACACACTCACTCCTTCAGAGGGTGCTGCTTCGGCCAGAGTGCGTG TTGGCCCAACAGATGAACGCGTCTTTGGATGACGTTTACGTACTCTACAGTCACGTCAGTGCTGCTCTTTTGCGCCGGAA TAATTCTTTTTTATCCCCAACGCCAGTGGCTGCTGTCCTTTCTAGTCACCATCGCTATTTTATTTCCACTGGACAGGAGT GCTTGGATGGTGCCCTGAGGGGTGGTTTGGGCTGCGGATTGATCACGGAGATTACAGGGGCCACCGGCGCCGGAAAGACG GCATTTGCACTTAACCTTGCGATGCGTGCCGCAAGTTATCCCAAGAAGGATGACAGGAGGTCCTGCACGCTGTGGATTAC CACAGATGTTTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048093340761AI065354TENU2241T. cruzi epimastigote normalized cDNA Library


Date: 11:38:5 on Wed 22 Nov 117.