EST 1804824 is a singleton


Sequence

>1804824 (1 EST) Length=367 ATGCGGGCTGAATTCTCTCGACATGATTCCACTCCTGTGCGGTCGCACGGCTGACGGCCAAACGGAGGATGCACCGCCGC CGCCCCCCCGCAGCATCACTGAGGCACATCTCAGCTTCAACGCCATTGACAGCCGCTCTTTGTGCCGCCTCTCGCATCTC GCCGCCACCCTCCAGACCCTCGTCCTTGACAACAACGAGCTGCAAGAGGTGTCGTCGCTTCCGCCGTTGCCGGGGCTTCA GCGGCTGTGGCTTAACAACAACCGCCTCGTGGGCCTGGAGGACGTGTTGACTGTTGTCTCCATGCAGTGCCCGGCGCTGA CGTATCTCTCGTTGCTCCGCAACCCCTGCTGTCCGAGTGAACTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804824: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048243340776AI065369TENU2256T. cruzi epimastigote normalized cDNA Library


Date: 13:29:22 on Fri 24 Nov 117.