EST 1804828 is a singleton


Sequence

>1804828 (1 EST) Length=286 GTGCAGTGAGTGTATTCGAGATGTTTTGATAGACAAGGAACACCACTTCCGGTGCATTCAATGTGATCAAAGTGAGGGGG TGGTGTGTTGGATGTGTTTTGCAGCTGGAAAACATCCACAACATCATGTGTTATTGCGCGTTCCCACATTCTCTGAGACG ACTTTAAATCTTCTTTGGGGTCCATCTAATGTGTCGCCTTTGGCTCTTTTCTGTGGAAAACTTGTGTCGAACATAAATGA AACTCATGTCGGGGTTTACTGTAATGGTTGCTCTCAACTTATATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048283340780AI065373TENU2260T. cruzi epimastigote normalized cDNA Library


Date: 7:24:30 on Sun 19 Nov 117.