EST 1804833 is a singleton


Sequence

>1804833 (1 EST) Length=414 TCCTAACGCTCTAACTTATATTCCCCAGTCTTCTCTCTCACTCACTCACTCTCTCTCTCAGTGTATGCGTGCGCCTGTAT GGCTGCCATGATTTCACGTGGTATTCGTGAGTCTCGCCAACGCGACACGCTCCAAATCATTGTTTACGTCAAAGAGGTCG GTAATCCTATAATGCGGGTAACACACTGTGGCACGCCGCAATAACTCCTCGAGTCCTTGCCGTTGGGCCCGCAATTCGGC CAGCTGCTCGCACTGTCGTTCAAGATCGTTGCCGGTGTTCTCCGAACGGTCCCGCGACATGGTAGGCGAGTAATGAAACG TTGACAACGACGCGGACGGTGACGATACGAGGTGCTTTGCGGCGGCCGTGGTAACAGACCGCCAAAGCTCCTTGAAGGAT GCAATATCTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804833: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048333340785AI065378TENU2265T. cruzi epimastigote normalized cDNA Library


Date: 3:49:51 on Sun 19 Nov 117.