EST 1804847 is a singleton


Sequence

>1804847 (1 EST) Length=480 AAAGCAAATACAAGAAAAAGAAATGAACTTCGGTTCTTTCTTCATTTCCCTTTTGTTTCTCAATTCCTTTTTTTTTTTCG TTCACCTTCCTTCGCGTCGTTGCTCAAGGTTACGATCAGCACCCTTTCCTAAACGTGCTGAGGCTCGTTGTATTAACAAG CTCCTCTTTTTTTTTTGTGCCGGGCGTTACGGCTTCGGGATGTATCGTTTTGCCTCATTCTCGTCCAACTGACGAAGGTC AAAATCTATTTCTTTCATCTCTTGCAGGACTTCTCCAATGGAGGTCGTCAATTCCTGCTCCAACATCCGCCGCTCCAGCG CCATGACGGGGTCACGCCTGTGGAACCGTCGTATAATCTCCGCCCCCGAAGGAATGATCTCGTTTTCATTGCCCTTTCCA TCGGCCACTGTTTCAGGCAGCGAGATTTCTGTGGCTGCTGTCGTAGTTGGCGGAGTCCTCGCGCAAAGGTCAACGTGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804847: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048473340799AI065392TENU2279T. cruzi epimastigote normalized cDNA Library


Date: 8:39:35 on Fri 24 Nov 117.