EST 1804848 is a singleton


Sequence

>1804848 (1 EST) Length=480 CGTCGTGGCTCAACGGCAAAACCTCACGCATGCGTGAAGAATAAAACACCCGCAAACACACACAGAGAAAAAGAGGAAAA ACACGGAAATGTAAAAGAAAAAAAGCCCATCACGGCTTCAATGCAAACGTCATGCTTACACCGTAGTGATCCGAGGGAAA CAAGTAGCCAGGAGCGTCCTTATTGCCATTCTCGTCGTTCACACTTTTAGTGCCTACAAGGTGCCCCTCCACCGGAGCAA GACGACGACTGCGCAAAAACAATTTATCCGAACGTCCAAAAAACATCTCTTCCACCTTCAGTTTGCAAAATGTATTCGTC TCGTCCATCGTTTTTCCAGCATCGTGTGGGTAAATAAGCGGCCAACAATCAACGTATTGTGATTCCGCCGGCATAAGACA CTCATTTGTGGGCCAGTCGTTAAAGTCGCCCATCGTCACAACATCACCAGTCAATGTCTTTAACATGTGATGCCGCAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804848: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048483340800AI065393TENU2280T. cruzi epimastigote normalized cDNA Library


Date: 18:49:21 on Thu 23 Nov 117.