EST 1804850 is a singleton


Sequence

>1804850 (1 EST) Length=426 TCAATCGAACAATGACGGCACCGTATCAAAGTGCCCACTCACTTGTTAACAAATATCGAGGCGTATGGATTGAGCTTGAC ATGCATCCCGCTTTTCGCGTAGCCTGGAGCCACAGTTACGCAAACTGCCCCAAGGACGTACCATACCAAAAACATCTGTA GATGAAGTTATTTCGGATTATATTAATACGGCACACCTTATCCAGGACGAAATGACGAGAGATCTTTGGCTAGCAAAGGT GCTTCAACACTGTGCATTTCAGAGAAGCAACGAGGGCATGGCACTCTGGGAGAAGTACTGCCATTCACGCTTTATAGCTG ATGGGGCTACTGCGACGCCACCGCTCCCCCTAGTCAAGGCCATTCTGTTCTACTGTAGCAAAATAGATTACCAAGGGTGG AGCTCTATTTTTCAAAAATGCTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804850: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048503340802AI065395TENU2283T. cruzi epimastigote normalized cDNA Library


Date: 21:24:39 on Sun 19 Nov 117.