EST 1804865 is a singleton


Sequence

>1804865 (1 EST) Length=507 TGCATATATATTTCTTTTTGAAGGTGATAAGAAACACACAAATAAGCATTCAAAGCAGTCATGGGAAACGACATCAAAAG GAAAAACAACCGCCAGCAGTAAAAACGCCAAGAGAATAATATGGTTTTTTTTGGGGGGGGTTAATGTATCAATAAGCCAG TGCCAACAACCGTACTGCTAGCGCCGCCGCTTGAATGCAACGACAACAATCACGGCGGCCACGGACAATAAAGCTACGAT GCCGAATAAGCATATGAACAATCTGTCCTTCTGTAGCTGCAATCGAAACCAGCGCAGATCACGTCTCACTCGGTGCAAAA TTGGCTCGTTTGTCTCTAACGCAGTGTCAATAACCTCAATAATCTCCTTGTCCTGCGCAACTGCTGTCTGGCCTCCCTAC CAATATCTTCCGCCGTGTTCATGATTTGCTCGGTCCTGTCAATTGCCTCAAGGGTCTCCAGCTGCACTTCTACTGCCTCG CGAAGCAGCCGATGTCAGCTGTCTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1804865: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048653340817AI065410TENU2298T. cruzi epimastigote normalized cDNA Library


Date: 21:47:48 on Fri 17 Nov 117.