EST 1804869 is a singleton


Sequence

>1804869 (1 EST) Length=406 TAAAAAAAAACAGGAAAAAAACATAAATCCCGATATTTATAACGTCGACAGGCCCGTGTATAATGTGCTGCACACCCGGA CACAATGGGGCTCGTGTCGCCTAAATTGTACTGTTACTCTGCAAGCTCCTCAAGAACCTGCTGCACGGTAAGCTTGTATT CATTCGCAGAGGCAGCATGTGTGCCGCAAGCTGGGCGACTTCCACCATGCCCTGCTCGTTCAGCTCGAGCCCATCCATGA CGCGATGATATGCGTCCACATCAATCTTCTCATTCATGCGGGTTAGAATCGTTAGCACCTCATCCGACGTGAGTGCCCCG GATTCACGTGAGTCAAATACCTGAAATGCCGTTGCCAATTCCTTCTCTGAGCTAAAATCCTCCGCCTTGAGGATGTCCTT TTGCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1804869: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048693340821AI065414TENU2302T. cruzi epimastigote normalized cDNA Library


Date: 15:25:24 on Thu 23 Nov 117.