EST 1804876 is a singleton


Sequence

>1804876 (1 EST) Length=388 TAAAAGGTGGGGGAAAATATAACCCTCAATTGGGCTTCTTTCATACGCGTCCTCCTTCGTGGGATTCAAAAATAAAAAAA AAGAGGAAAAAAAAAAATGGCGATAAAAGAGCGAAAAAACAAACAAACAACAACAACGATGGGAAGGACTTCACAAACAC ACGCAAGAAAACAGAAAAAAAAATGAAAAAAAGAAAAGGAAAGGAGAAAGTCAAACTCAAATTGTTGCGATACATTGGCT CAAACTGAAGGCCTTACACATTCTAGGCTCTCCTTCACACACGCATGTAGATGTATTCTTTATTGTTCCCTAAAGGGGCA TTCTTTTTCACTGTGAGGGCGTGGGGTTTTTGGTCACTCCTGGCTTCCCTCTTTCTGCTCCATGCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1804876: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18048763340828AI065421TENU2309T. cruzi epimastigote normalized cDNA Library


Date: 14:12:55 on Sat 18 Nov 117.