EST 1805609 is a singleton


Sequence

>1805609 (1 EST) Length=412 CGGCGTTGGAACAGGTCCGCACTTTTCCCAGAAGCTCAGTTCTGGCTGCGGCAACTCTCCCCCGATGCGCCCGACGCACG CGTCTCTCTCTGTGCCTCCGTATCAACAGAAAAAAACAAAGTATTAACTCTTACCCTTTCGCCCGTGGAAGCCGCGCTGG CTGTATCGGTGGCTCTTCGGTACTTTTGGCGGAACGTTGTTTTATTGAAGGACCGAGAGGGCAGTGGTAGACCCGCGTTG GGTCCTGCGAGGTTTCGTTCGGCGGATCTGTATCTCCATTCTCTTCCCATGGAGGAATATATTTCGTACGGCTTAGAGGG GCCGTACTTTTCGGACGTCGAGGACGAGGCAAACGTCCACTCCAACATTGAGCAAATAGCATGGAATCTCCGGGATTGCA TACTTTCACATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805609: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056093366266AI066376TENU2492T. cruzi epimastigote normalized cDNA Library


Date: 6:10:20 on Thu 23 Nov 117.