EST 1805617 is a singleton


Sequence

>1805617 (1 EST) Length=507 GAGCGCGAGGAGGTTGCCCATTTTGAGCAGGAGTTTTCGGGGAAAAGGGGGCCACCGCGAGTTTAACAAAGACCGCCTTT TTTGGAAGGGGAGCAGGCCCGACGGATTTTTGCCAACACATTTAGGAGGGATGGGGAAAAAAGGATGAGGGGCGCCTGCG TTGCTGTTTCCTTCGCCACATTTCCAAGGGCGTTCATACAGAAAAAGGTTGCTGCCGACGGCGTACTCCGCCTGATAACT GTGGAGTCAAGGGATCGTCAGCGCACTGCACAGATTGCCGTGCCACCCAACTTGGCAAAGTCCTGTAATGCCTCTTCCGA CCCCGCATCCTCATCCCTGTCACCATGCCATTCTTCATTTCCGTGGTTTTGTGCGTTTGATGGCGCTTCCGCTGGGGAAG GAGAAGAACTGCCCATGTTGGGAACGTTTGTTCCGCCGTGTGGGCTGCTACTGGCTAGTGCGCCTTGTGATGAGTCAAGA ATGTTGGTTATCCCGGACGATGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805617: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056173366274AI066384TENU2500T. cruzi epimastigote normalized cDNA Library


Date: 5:56:5 on Thu 23 Nov 117.