EST 1805620 is a singleton


Sequence

>1805620 (1 EST) Length=403 ACACAGATTGAGCATGTTGCCGTGAAGGTGCAGTACCCTGGTGTTGCAACAAGCATTGATTCTGATATTGCGAATCTGAA GATGCTGATTTCTTTGCATTTGCTTCCTCCAGGAATGTTTGTGGACAGAATTTTGCAAGACCTTCGTCAGGAATTTTTGT TGGAATGCCGCTACAAGATAGAGGCAGCAAAGCAGGTGCGGTATGCCGCTCTGATCAAGCAGGAACCAGAATTGCAAGAG GTGTTTGTTGTCCCAAAAGTTTACGAGTCCCTCTCAACAGAAAACGTGTTGGTGACGCAGTTTGTTACCGGTATTCCTGT TGACCGACTGGCGAACATTTCAGGTGTGCAGGATCTAAAGAATTACGTGGCTGAGCGTATGCTTCTGCTAACGCTTACCG AAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056203366277AI066387TENU2503T. cruzi epimastigote normalized cDNA Library


Date: 4:54:53 on Sat 18 Nov 117.