EST 1805621 is a singleton


Sequence

>1805621 (1 EST) Length=436 GTACTATATTGGAGTGGGGGAAAAATGGCACCCAACATCATGGATGACTTGTCAGTCTACGGGAACGGCCGCAGGAAGAA GCCTCCTTTCAGCTACACACCGAATCTGGTGTGTCTGCCAAATCACATTGTATCAAAGCATGTGAGTATGTGCATGGATG AGGAGACGACCGAGTGGCTGAGGCTCGCAGGTGATGTGAGTGTAATGAAGGCGTTACTGTCCGGTATTTTGCGCGCCTTT TTTTCCCAAACAACATCCAACGGTATACTGAACCGCGGCGGCATGTTTGTCATGTCTACGGCACAGGCTGCGCAGCTGCT GTTGGGCAACGAGGATGACCAGCGCAGTCAAAGTCACCGCCGTTCGGGACACTTTTGGATAGGCGCCGGTCATGGCGGCC TCACATCACGGCTGCAGCCACTGTCCCAGCACGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805621: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056213366278AI066388TENU2504T. cruzi epimastigote normalized cDNA Library


Date: 2:30:49 on Mon 20 Nov 117.