EST 1805642 is a singleton


Sequence

>1805642 (1 EST) Length=538 TAGGGCAGTACGTGCGCATTGGAAATGATCTCTACGCCGTCACAGAGGTCTCGGATCGCACATTTGTACAGTACAGAGAG GAGCGAGTTCTTATGGGACGCTGTGGCATCAACGACTTCTCTTCGGGAGGTCACACCAAGGGGCGTGAGGACATAACGGC TTCCGAAAGAAGTGAGTGGCCGTCAAAATACTGCATGCGCGCCGCGTCCTACTCGCTTGCATCGTCACCACAAACGGGTG TACGTCATCAGTTAGTGCGCATGTGCTGGCTATGCATGCGCACCGAGGCGAACGTTATTACCCTGCCATGTGCGCATTTT GCCCTTTGTCTTGGCTGCGTGGAAACTTTGACCCACTGCTGCATTTGCCAGCGCTCCATTCATGCCACCATCGTACTAAA TGAAAACACAGACCAGAATGAGTTTTCAGATACGAGAAATCAATAGTTTTTTTTTTCTCTTATGCATTTTAAAGTCTATA TATATATATATGTACGTACATATGTTTGTAGTCGTGTTGTTGTTTCTTATTCCCCCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056423366299AI066134TENU2525T. cruzi epimastigote normalized cDNA Library


Date: 21:57:56 on Sat 18 Nov 117.