EST 1805648 is a singleton


Sequence

>1805648 (1 EST) Length=564 TATATTGGGATCGGGGGCTAGAAAGACGCTTTACACATTCTTTAAAAAAAAATTATTTGGCCTTTTTTGTGACTTTTTTT TAAAAATTAAAGCAAAAACAGATATCGATGGCGGCTCTTACTGACGAACAGATCCGTGAGGCGTTCAACCTCTTCGACGC CGACGGCTCTGGTGCCATTGACGCGGAAGAGATGGCTTTGGCAATGAAGGGGCTTGGGTTTGGTGACTTGCCACGCGACG AGGTGGAGCGTATGATCCGCACAATGTCCACGGACTCCAACGGCCTGATTGGGTATGGTGAGTTTGAGCGTGTGGTGAAG TCGCGCATGGCGAGAAGGACTCACCGGAGAGATACTGAAGGCGTTTCAGCTGTTTGACCTCGACAAGAAGGGAAAGATAT CGTTTGCCAACCTGAAGGAGGTGGCCAAGCTGCTGGGTGAGAACCCCGGGGACGATGTGCTGCAGGAGATGATTGCGGAG GCTGACGAGGACGGCGACGGCGAGGTCTCTTTCGACGAGTTTAAGAACGTCATGATGCAGATGCGCGGAAAGTAGAGGAT TTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805648: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056483366305AI066140TENU2531T. cruzi epimastigote normalized cDNA Library


Date: 4:43:31 on Wed 22 Nov 117.