EST 1805650 is a singleton


Sequence

>1805650 (1 EST) Length=355 TCCTTCCATTTTGTTTTAAACCCCCTTCCCACCCTCCTTAGATATCTATCTACCTATATATATGTGTGTGTGTGTGTGTG TGTACTTGTGGACATTTTTATATTTGCGCAATGGGGCGTGTTTTAACCCGGTTGAACACCCACCTTTCATGACTTCTCTT GTGTAGTGGACGTGCGTGCAGAGGGAGAGAGAGAGCGTCCATATTGGACGTTTTTTTTTCGGTCTGTCTGTATGTTTTTT TTTGTTTTTATTTTTTGCCTCATTTCTGTTGGTGACTGCCGTACCCGCACACTTTCGTGCATGCGTCTTACGACCACACG CACGCCATGCGTTTGGTCAAATTCCATCGTAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1805650: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056503366307AI066142TENU2533T. cruzi epimastigote normalized cDNA Library


Date: 7:29:6 on Sat 18 Nov 117.