EST 1805657 is a singleton


Sequence

>1805657 (1 EST) Length=542 ACATGTTGCAAGGAAAATAATAAAAAAAAAAAATGGCATGGAAGTAAAAAGATCCGGGCAGACAACGGTGTCAATAAAGC AAATGGGGAAGGACTGGGATTAGGCACACACACACAAATAAAAGAATATCATTGAGGCATGGAAAAAAAAGACCTAATAG TTGCTTCTAGTCCTTTTCACATCTTTGGCCCTTCTTTATCTTTTGTCGTTTATCCATAGAGGATGGTCCCTCAAAGAGTA AAATACGTAATTATTTGCCCAAACTCTGCTGGTGGGCTTGGGCGGCGCGTTATTAACACTCGCTTATTATCCCTTTTTTT TTTGCTTAGCTTTTTTGCATTTCATTTTTTAAAAGTTTTTTGCAGTTGCCGTTCTGTGTGTGTGTGTGTGTGTGTCTTCT TGCCATATTGCCGGAGCAATGTTCCACGAGAAAAGGGGCTCAGCAGATGATGACGCCTCTTTGTGGACTCCCTTGTTTTC TCATCGATTATATAATGCTTCTTTTCAATGATACCGGGCGCTGGAATGCGGCGACTGCGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1805657: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056573366314AI066149TENU2540T. cruzi epimastigote normalized cDNA Library


Date: 8:12:40 on Thu 23 Nov 117.