EST 1805661 is a singleton


Sequence

>1805661 (1 EST) Length=419 AGAAATGGGCAAAACGCACAAAAATTGAGCAAAAAAAAGTGCGTCGCGCAGCCCCACCGCGACAACGCAACCCGCAGCCC CCAAAGCAATGCAAAAGTTTTCAAAAAAAAAAACGGCAAAAAAACGGCAAAAAAAGCCGTAAAAAAAGCCAGAAAAAAAA AAGCAAAATAAAAAAAACGACAAAAAACAGCAAAACTTAGAAAACAAGCAGCAAAAAAACGGCACAAAAAAAAAATACAT CAGGCCCCTCACACACACAGCCTCCAGCACATCCACTAAAAAAAACATTTTACACTACACGCAAAAAAAGCAGCAGAAAA ACACATATAAACACAAATGCATACATCGGGGCCATGGCTGATGCAAGAAAAGAAAAAGCGCACCAACAACTCCAGCAGCC AATTAGAAGCCCGTAAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056613366318AI066153TENU2544T. cruzi epimastigote normalized cDNA Library


Date: 2:59:48 on Mon 20 Nov 117.