EST 1805663 is a singleton


Sequence

>1805663 (1 EST) Length=535 GGAATCCGGATTGCGTACCGGTTGCAGTTAAAGAGTTAGTCGCACCACATTGCCGCGCCGCTTTTGTCGTACCGGACCGA CGAGACTTTGTCCCCGTGAGTCTTCTGCAGCAGCAAAAACAACAGGCGGGCCAGCGAAATTCTTACACGCGGGTTGTTCC CATGCCTTGGGGAGAGCGAGACACATCGCCTGCCTTTGCGTGTTATGGCATTAAAGGAAATATGGCTGCGGTGGCAAAAA ACAGGAAGTGCATCCGGAATTTGCAGACTGTCCCTGTCTATGAAGAAGAGCACGATCTGCTGAAGACTGTTACTGATCTT CTTGGGCTGGAGCGTGAAACTCTGTGCCGGGGATCATCGTCACGCTGTAACTCCACTACAACTGGTCGACTCTTACCGAC GCAATCTAACGCCTGTTCACGGCAGCTAAGTCCTTCACCGCGATGCGCAAAAGGGTCAATGGAGGAGGCGACGCAAAAAA TCGACTCTTTAAAGGTCATGGAGCCGACCCCTGCAGAGAAGGAAAACGCAGCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805663: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056633366320AI066155TENU2546T. cruzi epimastigote normalized cDNA Library


Date: 15:34:36 on Fri 24 Nov 117.