EST 1805667 is a singleton


Sequence

>1805667 (1 EST) Length=511 TTCCCGCTCGAGAGGCTTTTTGGGTTGTGACGGCGCTTTTTAGCGGGTTTTTGCCCTCCGGCTACCATGAGCACTACACC TTGCAGTATGACCTGCAGGTGTACAATGAGATTGTTGCACAAAAATTCCCAGACGTGCATGTGCATTTTGCGTCAAAGAG TATTGATGTCTCTGTGTTTGCAAGCGGATGGCTACAAGGTTTGTTCTGCGCCCACTTCCCGTTCTGCACGGCTGCCCGTG TTCTTGATGTTCTGCTTGCTGAGGGCGATACAGCACGCTGGTGCGGTTTCTTGTTGCATTTACGGGAAAATTTCGGTCTG AGATTTTGACGATGGACAGCAGTGGATCGCTGGGCTACTTTGCGAATGAGTGGGCACGAAATTGTTTTAACATTGAAGAC GTTGTGCGCGCGATGGAAAAGGACGGCCTGAGGTCGGTTGTTCTCTCACGGAGGGAGGAACTAACGGGTGCCACTGTTGC GTCGTGATCTCAGACACTGTTGCTGCTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805667: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056673366324AI066159TENU2550T. cruzi epimastigote normalized cDNA Library


Date: 0:56:51 on Wed 22 Nov 117.