EST 1805670 is a singleton


Sequence

>1805670 (1 EST) Length=551 TACATTCCTTTCCCGACGCCCCCGCCAAGCCCGTTGTTGTTTCCTTTCGAAATTTTTCCTCCGGCAGCTTCAGTGTGCTG GGATGTAAGCAACGAGGTCCAGCACCTTGTTGGGAGTACCCGGTCCCGTCGTCGCACCATGAGGCGAGCTTCGCGAACGA TCGTTTAGAGAAATGCCGGCCTTGACGGCAAAGACGGACATCGGCGCGACGCCGTTCATGTCGCTGGAAACAACCTCGCC CTCCGTGCGGCCAAGAAAACTCTTCAGCTTCCCCTCGGAGGCTGCATCGGTGGCGACGCGGACTGCTCGTATGCCGCCGG CTTCTCCGGACGCGTGGTGAGGTCGACAACCGACACGTTTGGAGTCGGCACACGGAACGCCATGCCGGCCAGCCTGCCGT TCGGCGCGGGAATGCCTTTCTCGACCGCCTTGGCCGCTCCGGTGGCGGACGGAACGATTTTCCGCGTCGCACCGGACCGC CGCGCCATTCTTTGAGCGACGGACCGTCCGCTGTTTGTTGCGACGCCATGGTGGCACGCGCTGTGGTCATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805670: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056703366327AI066162TENU2553T. cruzi epimastigote normalized cDNA Library


Date: 12:46:26 on Tue 21 Nov 117.