EST 1805676 is a singleton


Sequence

>1805676 (1 EST) Length=304 GCAATGAGGATAAAGGTTTACCACCAGAGGTAGTGCGCCTGTGTTCACACGCCGTGCATATTCCTTCTCCTTGGATGCAG CAGTACGAGCAGCGGTGGCTACATCATGCAGACACAACAGCAAAGAAGGGGAATTGTGCCAAGGGGAAGAACGGGGTGGT GTTGGAAGACGATGTTGTCTTGTTGCGGCCACAGGAGGTGTCGTTGAATGTGAGTGCGGCTTCTGCCATCATTCTTGCCA CCCTGCTGGCCGGTGATCGAGTAGTTGAAATCCACCGAATTGGCCGATAATACGCGACACACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805676: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056763366333AI066168TENU2559T. cruzi epimastigote normalized cDNA Library


Date: 23:12:10 on Fri 24 Nov 117.