EST 1805687 is a singleton


Sequence

>1805687 (1 EST) Length=463 CCGCTGAAACGGGGCGAGGAGCCGCTGCCGCCGTGGTTGAAGATGAAGGTTGCGAAGTGCGTCTCACGTCTTCCGCGCTT CAACAGTATTCGAAAGTCCATGATAGAGAAGCGCCTGGCGACAGTGTGCGAAGAAGCCAAGTGCCCCAACATTGGCGAAT GCTGGTGTGGGGACGAGGAGGAGTGCACCGCGACTGCAACGATCATTGTTATGGGATCGCATTGCACACTAGGTTGTCGC TTCTGTTCCGTGCTGACAAGCCGCACGCCGCCTCCACTTGACCCAGACGAGCCGCAAAAAGTGGCAAACGCTGTCGCAGA GATGGGAGTTGATTACATTGTTATGACGATTGTTGATCGTGACGATTTGAATGACGGTGGGGCTGCACATGTTGTGCGAT GTGTGAATGCCATTAAGGAGAAGAACCCGTTGTTGCTTCTCGAGTCTTTGGTGGGCGACTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056873366344AI066179TENU2570T. cruzi epimastigote normalized cDNA Library


Date: 8:48:21 on Mon 20 Nov 117.