EST 1805688 is a singleton


Sequence

>1805688 (1 EST) Length=327 GGTGAGTGACGAGGCGAAGGGAATAACAGATCCACATGAAACAAACAAATTCCCCGAGAGAAGATAATAAAAATGAAAAT TTAAAAGAAAACTATCAAATAAATGAAATTGCAGCAACATCAACGAAAAAAAAAAAAAAAAATGCGAAATAACAGGCATA ATATAAAGAAGGACGAGAGAGAAGGGAAAAGGGCGGACAAATGTTAATCCTGAGGACTAAAGGGGAGGAGAGAGGCGTCA AACAGATGAACAGGAACAACACAAGAGCACAAAAGTAAGAAATACACCACCGCAGTGAATTGACTGCACGGGGATTTACT TCAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805688: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056883366345AI066180TENU2571T. cruzi epimastigote normalized cDNA Library


Date: 12:58:9 on Sun 19 Nov 117.