EST 1805702 is a singleton


Sequence

>1805702 (1 EST) Length=420 GTACGAGCACAATGCGTACTCGGCGGAGAAAAAAGATGCAGAAACAGCTGCAGCAGCACGAGCAGCAGCAGATTTGGCTT ACAGGAGAAGGGGAGGATTTTTTTCAACAGTCATCTTATCCCCCCACACGACATGCATCATCTAGCGGGCGGGCACCTGC AGTGTGAAGACACCCTTTTCCTCTGGTACTGCAGGGGCACCGTACAATAAGAAGTTGCGCAAGAAGAACATGCAGCAGCA ACAACAACAACGCCACCACTTTTCGTTTGGGTGTAAAACGGCTACAAATAATGGCGGGGAGACGAGCTCTTCTTCTTTTT TCATCTCTCCCACACACCGTGTAGTAGCAGAAGCAACAACGCCGTGGAATAACGCATACGGCACTTCTGCAGGGCGTTAC CATTTCTTCGGTCAGGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805702: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057023366359AI066194TENU2585T. cruzi epimastigote normalized cDNA Library


Date: 18:21:49 on Fri 17 Nov 117.