EST 1805705 is a singleton


Sequence

>1805705 (1 EST) Length=523 TCCCTGCCCTCCGCGACGGTGGCTATTCGAACAGTCCCAAGCCTGCCGCTCGGGTTTTAATGCGTCCGGCTTGCGTGTTG GCCACGGCACGCAGTCTCGTATGGAATGCACCGCTCGCACCCACCTCCACACGGCAGTGAAGGGATGAGACGGGCGGGTA AATTATTCTCTTCGTCTGCGTGGATTTGTGCCATTGGGAGAGATGCACACTGTATATCATGCAATGTATATATGTATGCA GATGGATGTGGTGTGGATGACGTGCGGGTGTTGTGTTTAGAAGGCAGAAAGGAAGACCCAAAAAATAAATGGGGTGAAAG TTTTTTTTCTTTTTTCTCAATTCACCCATCTTTGCAGTGGTCATCACATTGCATGCATGCTGTTCATTTCTTCCTTTGTG CATCTTTCCTTTTTTTTTCTTTTTCTTCTTCCTCCCTCTCTCTCTTTCCCTCTTTCTGTACGTACGCATGCATGTATTTT TTTTATTGGCATGATGGCTTTGGGTTGGACGACAGATGACTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1805705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057053366362AI066197TENU2588T. cruzi epimastigote normalized cDNA Library


Date: 23:49:18 on Fri 17 Nov 117.