EST 1805711 is a singleton


Sequence

>1805711 (1 EST) Length=493 TCCCCCGAGCGAGAAGTGGTGCACAATGCCGAATGGGAAGCGATTCCCCATCGCCGGTGTCCAAATTCAACGGGAGGCGT TCCCGCAGTACAGCCCCGAGTTACATTTCTTTGCCTTTGATATTAAGTACTCTGTGAGTGGGGCGGAGGAGGACTTTGTG CTGCTTGGATACGACGAGTTTGTGGAGTTTTGCTCCAAGATTCCAAATCTGCTTTACTCCAAAGCACTTGTGCGCGGGAC CCTTGACGCATGCCTGGCGTTTGATGTGGAGAACTTCCACACCCCTCTGCCGGCACTTTTGGGCCTTGGCAACTACCCGC TGGAGGGGAATCTCGCGGAGGGCGTGGTCATCCGACACGTGCATCGTGGGGATCCGGCGACTGAAAAGCACAATGTCGCG ACGATCTTGAAGCTGCGCTGCTCCAGCTTTATGGAGCTGAAGCACCCGGGCAAGCAGAAGGAGTTGAAGGAAACGTTTAT TGATACAGTGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057113366368AI066203TENU2318T. cruzi epimastigote normalized cDNA Library


Date: 10:32:57 on Mon 20 Nov 117.