EST 1805712 is a singleton


Sequence

>1805712 (1 EST) Length=379 ACCACCCACTACGCCTACCGCCCCTTTGGCTGCTCTGTTATAATTGCTTCCTACGCCGATGACGGTCCACAGCTTTTCGT CTCTGACCCGAGCGGAACAGTGGCCGGTTACTACGGCATAGCACTGGGAAAGGGGAAAACAGTGGCCAAGACAGAGTTAG AGAAACTGAATTTTAAATCACTTACCTGCGACGAGGCGGTGGTGAAGCTCACGAAAATCCTTCACGATGTGCACGATAAA TCAAAGGACAAATTGTACGAGTTGGAGGTGGCATGGGTGTGCAACAAGTCAAATTGTGTGTTTCAGCATGTGCCGAATGA CATGATCCCGAAACCCCCCACGTCGCAGTAGTAAGGAATGAAGGAAGGAGCGAAAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805712: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057123366369AI066204TENU2319T. cruzi epimastigote normalized cDNA Library


Date: 0:30:52 on Sat 25 Nov 117.