EST 1805714 is a singleton


Sequence

>1805714 (1 EST) Length=174 GGAATGGCGAGGCGCCGGGAGCGGGCGGCAGTCCCTCCGCTACAAAGGGCCGTGCGGCTGGCTCTCGTACAGCCTCGCAA GCGGCACCTGCCTCAGTGGGACGCCAAGCACGTGGGTGCGCCCGCCCCTGTGCGCCCCCTGCTGCACCAGAACAGCCTGC ACCACCTCGCGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805714: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057143366371AI066206TENU2321T. cruzi epimastigote normalized cDNA Library


Date: 11:56:36 on Fri 24 Nov 117.