EST 1805726 is a singleton


Sequence

>1805726 (1 EST) Length=352 TTTGTGATGCGACAAAACCGGGCGGACTCCTCATCATTTCTACGATGGACAAGTCCATTCGAACAGCTATTAGCCATATT GCTGTTGCGGAGTATCTCACTGCATTGGTGAGGCCAGGTACGCATGACTGGTCAAAGTTTGTTCCTCCCAAGGACCTTTC CAGATGTGCGCTACAACATCAGGTGCGTCAAGTAGACCTTCAATACATTGTGGCATGTCCGAACATATTAGTGTCGTTAT CTACCCGGCAAATGCAATTGGCCTTTTCGCTTTCAAAGAGGTTTGATACAGGTCACTATTTTAGGTCTGGTTTGAAGGTG ACAGCCCCTGCCTAAACCTTCAATTTGTAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805726: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057263366383AI066218TENU2333T. cruzi epimastigote normalized cDNA Library


Date: 6:14:54 on Fri 24 Nov 117.