EST 1805727 is a singleton


Sequence

>1805727 (1 EST) Length=377 CGGCCGGCGGAAGGAGTTGTGTGTGTGTGGGCGGCTGCGGTGCCTCATTGTGCATCTGCGCCCGGACGCCGTTTTTGACC TTTGCAAGTTTGGCGACGTTGCGCATGTGTTGTTGGGCTGGCGCACCGCATGCAGACGTTGCGGGCGCAGTGCGACTCTC TTAGTGAGTCCGTTCCTGCCGGCGTCCCGAATGTCTCTGTGCGCGTCCTGCCCGTAAATGGCTTTCGGTGCACTCCCAGT TGCACAGGCGGTGCTGCAGGCTTGCAGAGACGGATGTCGAGGCGGTGGCGGTGGGGGCGTTGTGGCCGAGGATTTGTTCG TGCAGTGGCCTGGTGCTGTGGACATGCGCTCTCTGCTCACCGGCAACCGACTGCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805727: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057273366384AI066219TENU2334T. cruzi epimastigote normalized cDNA Library


Date: 22:59:8 on Wed 22 Nov 117.