EST 1805739 is a singleton


Sequence

>1805739 (1 EST) Length=364 CCCCGACCCAATCCTCTTGTGTACAAGTGTCCCCAGCCCGCCGTCGTGGACCATGTGGTTATTTTGCCTCCCGGTGACTC CGAACGCTCGATGGATGTGGAGCANAAGATTGAGGTGATCACAAGGGAGGTTCGTGTACCGGAGCCGGGCGATAAATTTT CGTCACGGCACGGCCAGAAGGGTGTAGTTGGTCTTATCACAGATGGAGTCAACATGCCCTTCAATGAAAAGGGCATAAGC CCGGTATGATCATGAACCCCCATGGGTTCCCGAGTCGAATGACAGTCGGTAAGCTCCTGGAGTTGGTTAGTTCAAAGGTT AGCGCTCTTACGGGAACATTTGGAGATGGTACAGCGTTTGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805739: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057393366396AI066231TENU2346T. cruzi epimastigote normalized cDNA Library


Date: 8:22:42 on Wed 22 Nov 117.